Case report

A baby boy, with no family history of hypoglycaemia, presented with hypoglycaemia on day 42 of life. Hyperinsulinism was diagnosed at 49 days based on the finding of increased glucose requirement (15 mg/kg/min) to maintain euglycaemia. At a plasma glucose of 1.7 mmol/l the patient’s insulin concentration was 297 pmol/l (normal < 14 pmol/l); at a plasma glucose of 0.4 mmol/l, insulin was 75 pmol/l, 3-hydroxybutyrate was suppressed at 0.02 mmol/l (normal > 1.5 mmol/l), and the patient had a glycaemic response to glucagon of > 1.7 mmol/l. Diazoxide and octreotide treatment was unsuccessful and surgery was performed on day 84.

At surgery an adenoma was palpated and partial pancreatectomy (approximately 40%) performed. Histology confirmed an insulin staining adenoma with normal pancreatic tissue in the surrounding area. The patient recovered well, tolerated a 13 hour fasting interval at age 4 months, and has had no subsequent hypoglycaemia.

Genomic DNA was extracted from patient and parental peripheral blood leucocytes, and from patient paraffin embedded tissue using standard techniques. SUR-1 exon 10 sequences were amplified using standard polymerase chain reaction (PCR) conditions (GibcoBRL; Life Technologies, Paisley, UK) using exon 10 primers SUR-10F (5′–GTGGAGACGACCCGCA GGAAGGAG–3′) and SUR-10R (5′–CCTT GCATGTACGCAGCAGCACCC–3′). Equal quantities of PCR product was digested for at least two hours with Bsr1 using conditions as described by the manufacturer. Bsr1 digestion of wild-type product yields two fragments of 66 and 50 base pairs. The mutated allele remains uncut. For GATA23FO6 and TH7 microsatellite analysis, PCR was performed as above and analysed on a 7% Long Ranger gel run on a Pharmacia ALF automatic sequencing system (Pharmacia BioFech, St Albans, UK).

Results

Patient leucocyte DNA was screened for 24 previously identified SUR-1 mutations8 and 2 KIR6.2 mutations; heterozygosity for an SUR 1 intron 10 splice site mutation (1630+1 G→T) was discovered. This mutation had previously been identified in three other patients with hyperinsulinism. One was a compound heterozygote for this and another SUR-1 mutation, whereas in the other two the mutation was identified on the paternal allele with no mutation identified on the maternal allele. As this mutation destroys a Bsr1 restriction site, enzyme digestion of exon 10 PCR product was used to identify the mutation in patient and parental samples (fig 1), demonstrating that the mutation was paternally derived. Analysis of DNA from the patient’s normal pancreatic tissue demonstrated a heterozygous pattern of normal and mutant allele. In contrast, DNA extracted from adenoma tissue contained mostly mutant allele.

• Download figure
• Open in new tab
• Download powerpoint

Figure 1

Mutation detection in patient and parental DNA samples. Agarose gel showing products of BsrI restriction of SUR exon 10 sequences. The figure shows homozygous wild-type pattern for the maternal DNA, heterozygous (1630+1 G→T) mutation in the paternal, patient leucocyte and normal pancreatic tissue, but reduction to almost complete homozygous 1603+1G→T mutation in patient adenoma. PBL, peripheral blood leucocytes; T, tail of pancreas (normal); B, body of pancreas (normal); A, adenoma; M, 100 base pair marker.  

To investigate if this was the result of loss of the maternal allele we performed microsatellite analysis using 11p specific markers GATA23FO6 and TH. TH lies approximately 30 centimorgans telomeric to the SUR-1 gene with the GATA23FO6 between the TH and SUR-1. The results demonstrated a Mendelian inheritance pattern in the patient’s leucocyte and normal pancreatic tissue, and a loss of the maternal 11p in the adenoma (fig 2). Our results indicate that the hyperinsulinism in this case is as a result of a reduction to homozygosity of the SUR-1 mutation in the adenoma tissue.

• Download figure
• Open in new tab
• Download powerpoint

Figure 2

Microsatellite analysis of patient and parental DNA samples. ALF trace of (A) TH and (B) GATA23F06 microsatellite analysis. Lanes 4 and 13, size marker; lanes 5, 6, 7, and 13, 14, 15, peripheral blood leucocyte DNA from patient, mother, and father respectively; lanes 9, 10, and 18, 20, DNA from normal and adenoma tissue respectively. A Mendelian inheritance pattern is seen in normal tissue and almost complete loss of the maternal allele is seen in adenoma tissue. PCR products were identified by electrophoresis on a Pharmacia ALF. Open squares indicate PCR products, closed circles are internal size marker; open circles are external size marker.

Discussion

de Lonlay and colleagues5 demonstrated loss of heterozygosity (LOH) in focal hyperplasia of the pancreas. They proposed that the hyperplasia was either caused by a loss of the imprinted tumour suppresser genes H19 or P57KIP2, or an expression imbalance between H19 and IGF II. Their studies explain the hyperplasia in focal disease but do not adequately address the hypersecretion of insulin in the focal tissue. Beckwith-Wiedemann syndrome, a condition in which 20% have LOH of chromosome 11p (the region containing the SUR-1 locus) is associated with hyperinsulinism in 30% of cases, but the occurrence of hyperinsulinism in these patients does not correlate with the occurrence of the LOH.7 We propose a model where the somatic loss of the maternal 11p is the causative factor for focal hyperplasia but that the hyperplasia itself is not sufficient to cause insulin hypersecretion. With the additional presence of a paternally derived SUR-1 mutation, there is a reduction to homozygosity for SUR-1 in focal cells resulting in dysregulation of insulin secretion and ultimately to the hyperinsulinism phenotype. Resection of the affected tissue resulted in a cure in a similar fashion to the partial pancreatectomy performed by de Lonlay et al in focal hyperplasia, unlike autosomal recessive hyperinsulinism in which a 95% pancreatectomy is often insufficient. In conclusion, this case demonstrates a novel mechanism for the apparent sporadic inheritance of disease considered an autosomal recessive disorder.